Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
MFACR/mm9-circ-016597/mmu_circ_0000290 | |||
Gene | SMYD4 | Organism | Mouse |
Genome Locus | chr11:75203573-75204729:+ | Build | n/a |
Disease | Cardiovascular disease | ICD-10 | Cardiovascular disease, unspecified (I51.6) |
DBLink | Link to database | PMID | 28498369 |
Experimental Method | |||
Sample Type | Cardiomyocytes | Comparison | cultured primary cardiomyocytes with those subjected to anoxia/reoxygenation (A/R) |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TCTTACGCACCATCATCTTG ReverseGTGTGCAGATTTGACTGTTT | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Wang, K, Gan, TY, Li, N, Liu, CY, Zhou, LY, Gao, JN, Chen, C, Yan, KW, Ponnusamy, M, Zhang, YH, Li, PF (2017). Circular RNA mediates cardiomyocyte death via miRNA-dependent upregulation of MTP18 expression. Cell Death Differ., 24, 6:1111-1120. |